Chicken EST
(ChEST) Clones
Please note that the clone(s) being sent have
tested negative in our phage contamination assay. However these clones
should still be handled with care as no phage assay can be guaranteed
to be 100% accurate.
WHAT TO DO WITH YOUR CLONES WHEN YOU RECEIVE
THEM
The clones have been streaked onto
LB agar containing 50 µg/ml carbenicillin. Please store them
at 4°C (not in a freezer).
As soon as possible, re-streak the clones onto the same medium and incubate
overnight at 37°C to obtain single colonies.
A selection of at least 10 single
colonies should be picked and grown in LB broth containing carbenicillin
+ 8% glycerol for subsequent freezing at -70°C. These frozen stocks
can then be re-grown for plasmid isolation and purification.
Streaking out for single colonies
is essential in case of contamination or cross-contamination, or if modifications
of the original clone have taken place as the library has been replicated.
If there is a problem, the more single colonies you streak out, the more
likely it is that you can retrieve the original construct. You can also
isolate the original clone from a contaminated sample by following this
procedure.
Vector Information
NB: This vector has been used only for clones from
plate 1 of the library (ChEST1a1 - ChEST1p24)
Vector information: Insert flanking sequence pcDNA3.1 vector
Vector Information:
| -Vector name |
pcDNA3.1 |
| -Cloning sites and orientation
of library inserts (5'/3') |
NotI/EcoRI |
| - Promoter 5' of the inserts |
T7 |
| - Sequencing primer 5' of the
inserts |
T7 |
| - Sequence 5'of the inserts (5'-NNN
NNNinsert) |
TTTAAACGGGCCCTCTAGACTCGAGCGGCCGCGGCTCGAG |
| - Promoter 3' of the inserts |
pcDNA3.1BGHreverse |
| - Sequencing primer 3' of the
inserts |
pcDNA3.1BGHreverse |
| - Sequence 3'of the inserts (5'-
insertNNN
NNN-3') |
AAGAATTCCACCACACTGGACTAGTGGATCCGAGCTCGGT |
NB: This vector has been used for
all clones from plate 2 onwards (ChEST2a1 - ChEST1038p24)

Vector information: Insert flanking sequence pcDNA3.1 vector
Vector Information:
| -Vector name |
pBlueScript II KS+ (Stratagene) |
| -Cloning sites and orientation of library inserts (5'/3') |
NotI/EcoRI |
| - Promoter 5' of the inserts |
T7 |
| - Sequencing primer 5' of the
inserts |
M13F |
| - Sequence 5'of the inserts (5'-NNN
NNNinsert) |
GCGAATTGGAGCTCCACCGCGGTGGCGGCCGCGGCTCGAG |
| - Promoter 3' of the inserts |
T3 |
| - Sequencing primer 3' of the
inserts |
M13R |
| - Sequence 3'of the inserts (5'- insertNNN
NNN-3') |
AAGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAG |
pBluescript II
KS(+/-) Multiple Cloning Site Region
(sequence shown 598-826)

RECOMMENDED METHODS FOR ISOLATION AND PURIFICATION OF DNA:
Plasmid DNA mini-prep preparation
Any standard mini-prep method is suitable. Below
is the method used in-house at Geneservice
a) Streak out plasmid onto LB + ampicillin (or
chloramphenicol [CM]) plate. Incubate overnight at 37°C (amp.) or
30°C (CM).
b) Dispense 5ml LB medium into a 50ml sterile tube. Add appropriate antibiotic.
Inoculate with a single colony and incubate overnight in shaking incubator
37ºC [30°C (CM)]/170 rpm.
c) [If a glycerol stock is required, transfer aliquot of 140µl to
a 1.5ml microtube. Add 40µl 80 % glycerol. Mix and freeze.]
d) Take 2ml of the plasmid broth, transfer to a 2ml microtube, and centrifuge
15 min 3000 rpm.
e) Pour off supernatant and discard. Re-suspend pellet in 200µl
GTE.
Add 5µl RNAase A stock (10mg/ml). Incubate 10 min. room temperature.
f) Lysis: Add 400µl 0.2M NaOH/1% SDS (freshly made). Mix by inversion.
Place on ice for 5 min.
g) Add 300µl 3M K Ac. Invert to mix. Place on ice for 10 min
h) Centrifuge 10 min at 13000 rpm in microfuge. Decant supernatant into
a 1.5ml microtube
containing 1ml cold ethanol, vortex briefly and leave to stand for 30
min. on ice.
i) Centrifuge 10 min. at 13000 rpm in microfuge. Remove ethanol carefully
(preferably by suction technique).
j) Add 200µl cold 70% ethanol, vortex briefly, centrifuge 10 min.
at 13000 rpm in microfuge, remove ethanol carefully (as above).
k) Air dry pellet. Add 50µl TE and leave to re-suspend overnight
at 4°C.
Solutions:
10 ml GTE:
0.5 ml 20% glucose
0.25 ml 1M Tris/HCl pH 7.5
0.2 ml 0.5M EDTA pH 8.0.
9.05 ml sterile distilled water
Lysis Buffer:
100 ml 0.2M NaOH/1% SDS = 0.8 g NaOH
5ml 20% SDS
95ml sterile distilled water.
PEG purification of plasmid DNA (strongly recommended
before sequencing).
a) Add an equal volume of 20% PEG solution in 2.5M
NaCl. Incubate at room temperature for 5-10 min.
Spin for 10-15 min. at 13,000 rpm.
b) Remove supernatant and rinse pellet with 70% ethanol. Dry the pellet.
Resuspend in 20µl sterile
distilled water.
c) Remove 5µl and add to 2µl loading buffer. Run out with
appropriate DNA marker on a 1.5% TBE
agarose gel to check that DNA recovery is good.
d) The DNA is now ready for sequencing.
General PCR Purification Method
Clones can be amplified by PCR using the appropriate
flanking primers. PCR products should then be purified using spin columns
or the sAP/exo1 (shrimp alkaline phosphatase/exonuclease1) method prior
to sequencing.
Werle. E, Schneider. C, Renner. M, Volker.M and
Fiehn. W. (1994) Convenient single-step, one tube purification of PCR
products for direct sequencing. Nucl. Acids Res. 22: 4354-4355.
Hanke. M and Wink. M. (1994) Direct DNA sequencing
of PCR-amplified vector inserts following enzymatic degradation of primer
and dNTPs. BioTechniques 17: 858-860.
Version 1.2 22nd October 2002
|